uid=AND,o=lter,dc=ecoinformatics,dc=org all public read WE035 Marie I Tosa

104 Nash Hall, Department of Fisheries, Wildlife, and Conservation Sciences, Oregon State University Corvallis OR 97331 USA

marie.tosa@oregonstate.edu tosa.marie@gmail.com http://orcid.org/0000-0002-9020-5098 Taal Levi Taal.Levi@oregonstate.edu http://people.oregonstate.edu/~levit/ http://orcid.org/0000-0003-1853-8311 Damon Lesmeister

PNW Research Station; 3200 SW Jefferson Way Corvallis OR 97331

541-750-7342 damon.lesmeister@usda.gov https://www.fs.fed.us/research/people/profile.php?alias=Damon http://orcid.org/0000-0003-1102-0122 Marie I Tosa

104 Nash Hall, Department of Fisheries, Wildlife, and Conservation Sciences, Oregon State University Corvallis OR 97331 USA

marie.tosa@oregonstate.edu tosa.marie@gmail.com http://orcid.org/0000-0002-9020-5098 Marie I Tosa

104 Nash Hall, Department of Fisheries, Wildlife, and Conservation Sciences, Oregon State University Corvallis OR 97331 USA

marie.tosa@oregonstate.edu tosa.marie@gmail.com http://orcid.org/0000-0002-9020-5098 Creator Taal Levi Taal.Levi@oregonstate.edu http://people.oregonstate.edu/~levit/ http://orcid.org/0000-0003-1853-8311 Creator Damon Lesmeister

PNW Research Station; 3200 SW Jefferson Way Corvallis OR 97331

541-750-7342 damon.lesmeister@usda.gov https://www.fs.fed.us/research/people/profile.php?alias=Damon http://orcid.org/0000-0003-1102-0122 Creator Taal Levi Taal.Levi@oregonstate.edu http://people.oregonstate.edu/~levit/ http://orcid.org/0000-0003-1853-8311 Principal Investigator Damon Lesmeister

PNW Research Station; 3200 SW Jefferson Way Corvallis OR 97331

541-750-7342 damon.lesmeister@usda.gov https://www.fs.fed.us/research/people/profile.php?alias=Damon http://orcid.org/0000-0003-1102-0122 Principal Investigator 2022-12-07 There are increasing concerns about the declining population trends of small mammalian carnivores around the world. Their conservation and management is often challenging due to limited knowledge about their ecology and natural history. To address one of these deficiencies for western spotted skunks (Spilogale gracilis), we investigated their diet in the Oregon Cascades of the Pacific Northwest during 2017 –2019. We collected 130 spotted skunk scats opportunistically and with detection dog teams and identified prey items using DNA metabarcoding and mechanical sorting. Western spotted skunk diet consisted of invertebrates such as wasps, millipedes, and gastropods, vertebrates such as small mammals, amphibians, and birds, and plants such as Gaultheria, Rubus, and Vaccinium. Diet also consisted of items such as black-tailed deer that were likely scavenged. Comparison in diet by season revealed that spotted skunks consumed more insects during the dry season (June –August), particularly wasps (75% of scats in the dry season), and marginally more mammals during the wet season(September –May). We observed similar diet in areas with no record of human disturbance and areas with a history of logging at most spatial scales, but scats collected in areas with older forest within a skunk’s home range (1 km buffer) were more likely to contain insects. Western spotted skunks provide food web linkages between aquatic, terrestrial, and arboreal systems and serve functional roles of seed dispersal and scavenging. Due to their diverse diet and prey-switching, western spotted skunks may dampen the effects of irruptions of prey, such as wasps during dry springs and summers. By studying the natural history of western spotted skunks in the Pacific Northwest forests while they are still abundant, we provide key information necessary to achieve the conservation goal of keeping this common species common. food webs predators genetics predation forest disturbance timber harvest terrestrial ecosystems forest ecosystems animals invertebrates vertebrates salamanders birds mammals plants LTER controlled vocabulary H. J. Andrews Experimental Forest (AND) Andrews Experimental Forest site thesaurus Funding: USDA Forest Service, PNW research station National Science Foundation (LTER7 DEB-1440409) Oregon State University Northwest Ecological Research Institute ARCS Oregon Chapter Acknowledgments of persons: A. Coombs, B. Murley, K. Van Neste, and R. Rich and Rogue Detection Dogs (formerly with Conservation Canines) – H. Smith, J. Hartman, M. Poisson, C. Yee, Chester, Jack, and Scooby – for field support. We thank Levi Lab technicians for laboratory support. We also thank J. Hedges, S. Speir, and H. Thomas for mechanically sorting scats. Facilities were provided by the H. J. Andrews Experimental Forest and the Long Term Ecological Research program, administered cooperatively by the USDA Forest Service Pacific Northwest Research Station, Oregon State University, and the Willamette National Forest.Related FilesTitle: Study area map with 3 x 3 km grid cellsDescription: Scat detection map identifying 3 x 3 km grid cell numbers within the study area of Blue River WatershedURL: https://andrewsforest.oregonstate.edu/data/studies/we035/scat_map_with_water.JPG Data Use Agreement: The re-use of scientific data has the potential to greatly increase communication, collaboration and synthesis within and among disciplines, and thus is fostered, supported and encouraged. This Data Set is released under the Creative Commons license CC BY "Attribution" (see: https://creativecommons.org/licenses/by/4.0/). Creative Commons license CC BY - Attribution is a license that allows others to distribute, remix, tweak, and build upon your work (even commercially), as long as you are credited for the original creation. This license accommodates maximum dissemination and use of licensed materials. It is considered professional conduct and an ethical obligation to acknowledge the work of other scientists. The Data User is asked to provide attribution of the original work if this data package is shared in whole or by individual parts or used in the derivation of other products. A recommended citation is provided for each Data Set in the Andrews LTER data catalog (see: http://andlter.forestry.oregonstate.edu/data/catalog/datacatalog.aspx). A generic citation is also provided for this Data Set on the website https://portal.edirepository.org in the summary metadata page. Data Users are thus strongly encouraged to consider consultation, collaboration and/or co-authorship with the Data Set Creator. While substantial efforts are made to ensure the accuracy of data and associated documentation, complete accuracy of data sets cannot be guaranteed and all data are made available "as is." The Data User should be aware, however, that data are updated periodically and it is the responsibility of the Data User to check for new versions of the data. The data authors and the repository where these data were obtained shall not be liable for damages resulting from any use or misinterpretation of the data. General acknowledgement: Data were provided by the HJ Andrews Experimental Forest research program, funded by the National Science Foundation's Long-Term Ecological Research Program (DEB 2025755), US Forest Service Pacific Northwest Research Station, and Oregon State University. Creative Commons Attribution 4.0 International Public License https://creativecommons.org/licenses/by/4.0/ CC-BY-4.0 https://andlter.forestry.oregonstate.edu/data/abstract.aspx?dbcode=WE035 HJ Andrews Experimental Forest and the surrounding Willamette National Forest (Blue River and Lookout Creek watersheds) -122.28668350 -122.12885316 44.30425907 44.18280497 438 1500 meter 2017-08-03 2019-01-25 All Organisms All Organisms Highest common category (ca. kingdom) Plantae Plants 202422 Division or Phylum Polypodiophyta 500003 Class Filicopsida 500005 Order Polypodiales 500029 Family Dryopteridaceae 500057 Genus Athyrium ladyfern 17408 Species Athyrium brevifrons Genus Dryopteris woodfern 17519 Genus Polystichum hollyfern 17674 Species Polystichum vestitum Species Polystichum weimingii Family Blechnaceae 17861 Genus Blechnum midsorus fern 17862 Family Athyriaceae Division or Phylum Coniferophyta gymnosperms 18024 Class Pinopsida conifers 500009 Order Pinales 500028 Family Pinaceae 18030 Genus Tsuga hemlock 183396 Species Tsuga heterophylla western hemlock 183400 Genus Pseudotsuga Douglas-fir 183418 Species Pseudotsuga menziesii Douglas-fir 183424 Division or Phylum Streptophyta Subphylum Streptophytina Class Polypodiopsida Division or Phylum Magnoliophyta angiosperms 18061 Class Magnoliopsida dicot 18063 Order Poales Family Poaceae grasses 40351 Genus Festuca fescue 40792 Species Festuca altissima Genus Avena oat 4024 Species Avena nuda Order Boraginales Subclass Magnoliidae 18064 Order Ranunculales 18409 Family Berberidaceae 18811 Genus Berberis barberry 18814 Species Berberis wallichiana Family Ranunculaceae 18410 Genus Coptis goldthread 18763 Species Coptis quinquesecta Subclass Rosidae 24056 Order Rhamnales 28444 Family Rhamnaceae 28445 Genus Frangula buckthorn 500850 Species Frangula purshiana Pursh's buckthorn 506987 Genus Ceanothus ceanothus 28453 Species Ceanothus pumilus dwarf ceanothus 28500 Species Ceanothus americanus Order Geraniales 29060 Family Oxalidaceae 29061 Genus Oxalis woodsorrel 29062 Species Oxalis tuberosa Order Fabales 500022 Family Fabaceae 500059 Genus Glycine 26715 Genus Arachis Species Arachis hypogaea Genus Cytisus broom 500235 Species Cytisus striatus striated broom 506932 Order Cornales 27788 Family Cornaceae 27796 Genus Cornus dogwood 27798 Species Cornus canadensis bunchberry dogwood 27816 Species Cornus kousa Order Sapindales 28643 Family Aceraceae 28726 Genus Acer maple 28727 Family Sapindaceae Soapberry Family 28657 Order Apiales 500017 Family Araliaceae 29371 Genus Aralia spikenard 29372 Species Aralia californica California spikenard 29373 Order Rosales 24057 Family Rosaceae 24538 Genus Spiraea spirea 25328 Species Spiraea pubescens Genus Rubus blackberry 24848 Species Rubus saxatilis Species Rubus occidentalis Genus Fragaria strawberry 24624 Species Fragaria vesca woodland strawberry 24634 Genus Oemleria oemleria 25267 Species Oemleria cerasiformis Indian plum 25268 Genus Prunus plum 24762 Species Prunus spinosa blackthorn 24802 Genus Sorbus mountain ash 25318 Family Saxifragaceae 24187 Genus Tolmiea youth on age 24532 Species Tolmiea menziesii youth on age 24533 Subclass Hamamelididae 500012 Order Fagales 19273 Family Betulaceae 19465 Genus Alnus alder 19466 Species Alnus alnobetula Species Alnus incana gray alder 19471 Genus Corylus hazelnut 19505 Species Corylus cornuta beaked hazelnut 19507 Family Fagaceae 19275 Genus Quercus oak 19276 Species Quercus pubescens Subclass Dilleniidae 21341 Order Salicales 22442 Family Salicaceae 22443 Genus Populus cottonwood 22444 Species Populus suaveolens Species Populus mexicana Genus Salix willow 22476 Species Salix zygostemon Order Ericales 23443 Family Ericaceae 23463 Genus Vaccinium blueberry 23571 Genus Gaultheria snowberry 23652 Genus Arctostaphylos manzanita 23467 Genus Rhododendron rhododendron 23700 Species Rhododendron aureum Species Rhododendron ungernii Family Pyrolaceae 23751 Genus Pyrola wintergreen 23752 Species Pyrola aphylla 23756 Order Malvales 21500 Family Malvaceae 21608 Order Oxalidales Order Saxifragales Order Malpighiales 822428 Class Liliopsida monocot 38881 Subclass Asteridae 29909 Order Dipsacales 35247 Family Adoxaceae Family Caprifoliaceae 35248 Genus Linnaea twinflower 35313 Species Linnaea borealis twinflower 35314 Genus Sambucus elderberry 35315 Species Sambucus williamsii Order Asterales 35419 Family Asteraceae 35420 Genus Taraxacum dandelion 36199 Species Taraxacum officinale common dandelion 36213 Genus Erigeron fleabane 35803 Species Erigeron cascadensis Cascade fleabane 35836 Order Solanales 500033 Family Solanaceae 30411 Genus Capsicum Species Capsicum pubescens Family Hydrophyllaceae 31356 Genus Hydrophyllum waterleaf 31388 Species Hydrophyllum canadense Family Convolvulaceae 30648 Genus Convolvulus bindweed 30701 Highest common category (ca. kingdom) Animalia Animal 202423 Division or Phylum Mollusca mollusks 69458 Class Gastrapoda Order Stylommatophora Family Polygyridae Genus Vespericola Family Arionidae Genus Prophysaon Species Prophysaon obscurum Family Haplotrematidae Genus Haplotrema Class Mammalia Mammals 179913 Order Artiodactyla Family Cervidae Family Bovidae Genus Bos Species Bos taurus Genus Spilogale 180569 Species Spilogale gracilis Western Spotted Skunk 552466 Order Rodentia Rodents 180130 Family Sciuridae Squirrels 180135 Genus Neotamias Species Neotamias townsendii Family Cricetidae Genus Myodes Genus Sorex Sorex species 179928 Species Sorex trowbridgii Trowbridge Shrew 179956 Genus Scapanus 179980 Species Scapanus orarius Coast Mole 179982 Genus Odocoileus 180697 Species Odocoileus hemionus Black-Tailed Deer 180698 Genus Neurotrichus 179974 Species Neurotrichus gibbsii Shrew Mole 179975 Genus Microtus 180296 Species Microtus oregoni Oregon Vole 180313 Genus Lepus 180111 Species Lepus americanus Snowshoe Hare 180112 Genus Glaucomys 180168 Species Glaucomys oregonensis Order Lagomorpha coelho, Hares, lagomorphs, Pikas, Rabbits, tapeti 180105 Family Leporidae Order Eulipotyphla Family Soricidae Family Talpidae Class Amphibia Amphibians 173420 Genus Rhyacotriton 173744 Species Rhyacotriton cascadae Cascade Torrent Salamander 550250 Genus Plethodon 173648 Species Plethodon dunni Dunn's Salamander 173654 Genus Aneides 173698 Species Aneides ferreus Clouded Salamander 173700 Genus Ambystoma 173589 Genus Taricha 173619 Species Taricha granulosa Roughskin Newt 173620 Family Plethodontidae 173631 Order Anura Family Hylidae Genus Pseudacris Species Pseudacris regilla Order Caudata Family Salamandridae Family Ambystomatidae Family Rhyacotritonidae Division or Phylum Chordata 158852 Subphylum Craniata Class Reptilia Order Squamata Division or Phylum Arthropoda Arthropods 82696 Class Insecta 99208 Order Diptera 118831 Family Psilidae 142120 Family Cecidomyiidae 122975 Order Orthoptera 102160 Family Gryllacrididae 102278 Genus Pristoceuthophilus 657767 Species Pristoceuthophilus cercalis 658692 Family Rhaphidophoridae Order Lepidoptera 117232 Family Lasiocampidae 117541 Genus Tolype Species Tolype dayi no tsn # Order Hemiptera 103359 Suborder Homoptera 109166 Family Cicadellidae 109171 Genus Macropsis 200046 Order Coleoptera 109216 Family Staphylinidae 113265 Genus Deinopteroloma Species Deinopteroloma subcostatum Order Hymenoptera 152741 Family Vespidae 154249 Genus Vespula 154274 Species Vespula consobrina 154275 Family Ichneumonidae 153360 Family Chrysididae 154152 Genus Ceratochrysis Class Diplopoda 154409 Subphylum Chelicerata Subphylum Myriapoda Subphylum Hexapoda Class Arachnida 82708 Subclass Araneae 82732 Family Theridiidae 82740 Genus Steatoda 849420 Species Steatoda bipunctata Family Araneidae 82737 Genus Araneus 847901 Species Araneus saevus 851719 Class Gastropoda 69459 Class Chilopoda 154400 Order Scolopendromorpha 913857 Family Cryptopidae Genus Scolopocryptops Species Scolopocryptops capillipedatus Class Aves Birds 174371 Order Accipitriformes Order Falconiformes 175262 Family Cathartidae 175263 Genus Cathartes 175264 Species Cathartes aura Turkey Vulture 175265 Order Galliformes 175693 Family Phasianidae 175861 Genus Bonasa 175789 Species Bonasa umbellus Ruffed Grouse 175790 Order Apodiformes 177993 Family Trochilidae 178028 Genus Selasphorus 178037 Species Selasphorus rufus Rufous Hummingbird 178040 Order Piciformes 178140 Family Picidae 178148 Genus Dryobates Species Dryobates pubescens Order Passeriformes 178265 Family Emberizidae 178838 Genus Junco 179409 Species Junco hyemalis Dark-eyed Junco 179410 Family Bombycillidae 178527 Genus Bombycilla 178528 Species Bombycilla cedrorum Cedar Waxwing 178532 Family Turdidae 179751 Genus Catharus 179778 Species Catharus ustulatus Swainson's Thrush 179788 Genus Turdus 179752 Species Turdus migratorius American Robin 179759 Family Motacillidae 178474 Genus Anthus 178488 Species Anthus rubescens American Pipit 554127 Family Thraupidae 179880 Genus Piranga 179881 Species Piranga ludoviciana Western Tanager 179882 Family Passerellidae Division or Phylum Rotifera Class Bdelloidea Class Eurotatoria Order Adinetida Family Adinetidae Genus Adineta Species Adineta vaga Species Adineta gracilis Highest common category (ca. kingdom) Fungi 555705 Division or Phylum Ascomycota 610624 Subphylum Pezizomycotina Class Sordariomycetes Order Hypocreales Family Nectriaceae Genus Neonectria Species Neonectria ditissima To provide a baseline for western spotted skunk diets in the forests of the Pacific Northwest

An update history is logged and maintained with each new version of every dataset.

notPlanned Study code and preliminary metadata established Version1 2018-03-22 Original creation of entities from Excel entity_attribute table using move_xls program. Ran QC. Uploaded to SQL. Version2 2022-12-07 Information Manager

Andrews Forest LTER Program US Forest Service Pacific Northwest Research Station 3200 SW Jefferson Way Corvallis OR 97331

hjaweb@lists.oregonstate.edu http://andrewsforest.oregonstate.edu/ Marie I Tosa

104 Nash Hall, Department of Fisheries, Wildlife, and Conservation Sciences, Oregon State University Corvallis OR 97331 USA

marie.tosa@oregonstate.edu tosa.marie@gmail.com http://orcid.org/0000-0002-9020-5098 Andrews Forest LTER Site

Forest Ecosystems and Society Department in Forestry Oregon State University 201K Richardson Hall Corvallis OR 97331-5752

(541) 737-8480 lterweb@lists.oregonstate.edu http://andrewsforest.oregonstate.edu/ Field Methods - WE035 We collected western spotted skunk scat in multiple ways: 1) during western spotted skunk capture, 2) opportunistically while tracking western spotted skunks with radio-collars and checking trail cameras, and 3) using detection dog teams (summer and fall of 2018). Detection dog teams either surveyed 3 x 3 km grids within the study area for a minimum of 6 hours near camera trap locations where we detected western spotted skunk or focused their surveys around known spotted skunk rest sites. Focused surveys were necessary to increase scat sample sizes and increase spotted skunk scat detection rates. Moreover, western spotted skunk scats were difficult to locate opportunistically because typically, they were deposited after we tracked skunks to their rest sites, were in hard to search locations such as in hollow logs or a short distance from the rest site. We froze all scat samples until we processed them in the laboratory, and processed scats were dried for long-term storage. Detection dog location and collection times where recorded with a handheld GPS. The collection times were originally recorded in local time (Pacific Standard, after 11/4/2018 01:59 AM, or Pacific Daylight, before 11/4/2018 02:00 AM, depending on the date). Pacific Daylight times were converted to Pacific Standard time in the database. Laboratory Methods - WE035 In the lab, we identified the diet of western spotted skunks using DNA metabarcoding (Massey et al. 2021; Eriksson et al. 2019) and mechanical sorting. For DNA metabarcoding, we extracted DNA in a laboratory dedicated to processing degraded DNA using the DNeasy Blood and Tissue kit (Qiagen, Germantown, Maryland) or the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, Maryland). We included an extraction blank with every batch of extractions as a negative control, where we used the same protocol but without a fecal sample (hereafter called extraction blanks). We kept extraction blanks throughout the DNA metabarcoding process. Following DNA extraction, we amplified 3 regions of the mitochondria and chloroplast DNA. First, we amplified a ~100 base-pair DNA segment of the ribosomal mitochondrial 12S gene using universal vertebrate primers (12S-V5-F’: YAGAACAGGCTCCTCTAG and 12S-V5-R: TTAGATACCCCACTATGC) (Kocher et al. 2017; Riaz et al. 2011) and the chloroplast-encoded intron region of the trnL gene using universal plant primers (g-F: GGGCAATCCTGAGCCAA and h-R: CCATYGAGTCTCTGCACCTATC) (Taberlet et al. 2007) in a multiplex polymerase chain reaction (PCR). In a separate singleplex PCR reaction, we amplified the mitochondrial-encoded cytochrome oxidase subunit I (COI) gene using ANML universal arthropod primers (LCO1490-F: GGTCAACAAATCATAAAGATATTGG and CO1-CFMRa-R: GGWACTAATCAATTTCCAAATCC) (Jusino et al. 2019). We performed 3 PCR replicates per sample using the QIAGEN Multiplex PCR kit (Qiagen, Germantown, Maryland) (Appendix S1). To aid in identifying contamination, we performed PCR on a negative control on each plate (hereafter called PCR blanks) in addition to the extraction blanks. Each reaction was amplified with identical 8 base pair tags on the 5’ end of the forward and reverse primer that were unique to each sample to identify individual sample after pooling and to prevent misidentification of prey samples due to tag jumping (Schnell, Bohmann, and Gilbert 2015). We normalized and pooled the PCR products and used NEBNext Ultra II Library Prep Kit (New England BioLabs, Ipswich, Massachusetts) to adapt the library pools into Illumina sequencing libraries (Illumina Inc., San Diego, California). We purified libraries using the Solid Phase Reversible Immobilization beads and sent libraries to the Center for Genome Research and Biocomputing at Oregon State University for 150 base pair paired-end sequencing on the Illumina HiSeq 3000. We paired raw sequence reads using PEAR (Zhang et al. 2014) and demultiplexed samples based on the 8-base pair-index sequences using a custom shell script (Appendix S2). We counted unique reads from each sample replicate and assigned taxonomy using BLAST against the 12S, COI, and trnL sequences in a local database and GenBank (www.ncbi.nlm.nih.gov/blast). Scat amplification was considered successful if DNA sequencing produced over 100 total reads per replicate, and we limited the effects of contamination by retaining only species that consisted of more than 1% of the total reads. Furthermore, we used extraction and PCR negative controls to set additional filtering thresholds for species read counts. Species were only retained in the final species list if it was present in at least 2 of the 3 replicates and if their species distribution maps included our study area or were included on the species lists of the study area (https://andrewsforest.oregonstate.edu/about/species). We identified plants to genus since congeners are difficult to differentiate using these primers. To mechanically sort scats, we placed dried scat contents in a petri dish and separated items using forceps. We identified remains macroscopically to the lowest taxonomic order possible (typically class or order). If we had used all fecal matter for DNA metabarcoding, we relied on notes on identifiable parts from when the scat was collected or processed samples for DNA extraction. Once mechanically sorted, we compared our findings to the DNA metabarcoding results for each scat. If the identified taxon was not included in the DNA metabarcoding results, we augmented the results with the missing taxon. We used mechanical sorting to augment results from DNA metabarcoding because of known biases introduced by mismatches in the universal invertebrate ANML primers we used, which is attributed to a lack of conserved regions across all invertebrates (Deagle et al. 2014). We confirmed scats as defecated by western spotted skunks using the metabarcoding data following criteria: 1) western spotted skunk was the only carnivore (order: Carnivora) identified in the scat, or 2) western spotted skunk was one of the carnivores identified in the scat and the other carnivores consisted of less than 10% of the read count. We confirmed the predator in this way because predators are frequently misidentified through scat morphology (Morin et al. 2016; Lonsinger, Gese, and Waits 2015). This study was centered around the H. J. Andrews Experimental Forest (HJA), which is located on the western slope of the Cascade Mountain Range near Blue River, Oregon (Figure 1). The area is surrounded by the McKenzie River Ranger District of the Willamette National Forest. Elevations range from 410 m to 1,630 m. The maritime climate consists of warm, dry summers and mild, wet winters. Mean monthly temperatures range from 1°C in January to 18°C in July. Precipitation falls primarily as rain, is concentrated from November through March, and averages 230 cm at lower elevations and 355 cm at higher elevations (Greenland 1993; Swanson and Jones 2002). During 2018 – 2019, western Oregon experienced an extreme drought (USDM 2022). In Lane County, drought severity was greatest during August 2018 – February 2019, but abnormally dry conditions began as early as January 2018 and moderate drought conditions began as early as June 2018 (Appendix S1: Figure S1). Lower elevation forests are dominated by Douglas-fir (Pseudotsuga menziesii), western hemlock (Tsuga hetemphylla), and western red cedar (Thuja plicata). Upper elevation forests are dominated by noble fir (Abies procera), Pacific silver fir (Abies amabilis), Douglas-fir, and western hemlock. The understory is variable and ranged from open to dense shrubs. Common shrubs included Oregon grape (Mahonia aquifolium), salal (Gaultheria shallon), sword fern (Polystichum munitum), vine maple (Acer circinatum), Pacific rhododendron (Rhododendron macrophyllum), huckleberry (Vaccinium spp.), and blackberry and salmonberry (Rubus spp.). Before timber cutting in 1950, 65% of the HJA was covered in old-growth forest. Approximately 30% of the HJA was clear cut or shelterwood cut to create plantation forests varying in tree composition, stocking level, and age. In 1980, the HJA became a charter member of the Long Term Ecological Research network and no logging has occurred since 1985. The Willamette National Forest immediately surrounding the HJA has a similar logging history, but logging continues to occur. Currently, the HJA consists of a higher percentage of old-growth forest than the surrounding Willamette National Forest (approximately 58% in the HJA vs. 37% in the study area) (Davis et al. In Press). Wildfires are the primary disturbance type, followed by windthrow, landslides, root rot infections, and lateral stream channel erosion. Mean fire return interval of partial or complete stand-replacing fires for this area is 166 years and ranges from 20 years to 400 years (Teensma 1987; Morrison and Swanson 1990). Sampling frequency: irregular Our western spotted diet study was part of a larger study on their spatial ecology in the temperate rainforest ecosystem of western Oregon that was conducted between April 2017 – September 2019. During this study, we set and maintained 112 baited trail cameras and captured and tracked western spotted skunks (nF = 12, nM = 19) using Tomahawk traps (Model 102 and 103, Tomahawk Live Trap Co., Hazelhurst, WI) and VHF radio-collars (M1545, 16 g; Advanced Telemetry Systems, Isanti, MN). Cameras placed in the HJA were paired with previously established long-term songbird monitoring (Frey, Hadley, and Betts 2016) and small mammal monitoring sites (Weldy et al. 2019). Cameras placed outside of the HJA were stratified based on elevation and old-growth structural index (Spies and Franklin 1988) and chosen randomly within logistical constraints. Both cameras and live traps were baited with a frozen house mouse (Mus musculus), a can of sardines (Culpidae), and/or various carnivore scent lures. We located skunks using radio-telemetry triangulation and homing techniques daily, weather permitting. Homing techniques were mainly used to locate rest site locations during the day whereas triangulation was used to locate skunks during the night when skunks were most active. All animal capture and handling were conducted in accordance with the guidelines set by the American Society of Mammalogists and were approved by the USDA Forest Service Institutional Animal Care and Use Committee (IACUC #2016-015) and the Oregon Department of Fish and Wildlife (Permit #107-17, 059-18, 081-19). Andrews Experimental Forest (HJA) -122.26172200 -122.10084700 44.28196400 44.19770400 1631 1631 meter WE035 unique location code F15-133 for collected scat sample within detection grid cell 15 -122.16929232 -122.16929232 44.28649046 44.28649046 895 895 meter WE035 unique location code F15-134 for collected scat sample within detection grid cell 15 -122.16929232 -122.16929232 44.28649046 44.28649046 895 895 meter WE035 unique location code F15-136 for collected scat sample within detection grid cell 15 -122.16929232 -122.16929232 44.28649046 44.28649046 895 895 meter WE035 unique location code F15-137 for collected scat sample within detection grid cell 15 -122.16929232 -122.16929232 44.28649046 44.28649046 895 895 meter WE035 unique location code F15-50 for collected scat sample within detection grid cell 15 -122.16941117 -122.16941117 44.28695048 44.28695048 870 870 meter WE035 unique location code F22-101 for collected scat sample within detection grid cell 22 -122.19017339 -122.19017339 44.26911148 44.26911148 783 783 meter WE035 unique location code F22-143 for collected scat sample within detection grid cell 22 -122.18905702 -122.18905702 44.26555636 44.26555636 829 829 meter WE035 unique location code F22-18 for collected scat sample within detection grid cell 22 -122.19456280 -122.19456280 44.26422685 44.26422685 869 869 meter WE035 unique location code F22-196 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-197 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-198 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-199 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-22 for collected scat sample within detection grid cell 22 -122.19521791 -122.19521791 44.26487969 44.26487969 849 849 meter WE035 unique location code F22-224 for collected scat sample within detection grid cell 22 -122.18248075 -122.18248075 44.27178461 44.27178461 784 784 meter WE035 unique location code F22-226 for collected scat sample within detection grid cell 22 -122.18300666 -122.18300666 44.27090608 44.27090608 817 817 meter WE035 unique location code F22-300 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-301 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-302 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-303 for collected scat sample within detection grid cell 22 -122.18267018 -122.18267018 44.25901962 44.25901962 847 847 meter WE035 unique location code F22-307 for collected scat sample within detection grid cell 22 -122.17943017 -122.17943017 44.26049090 44.26049090 850 850 meter WE035 unique location code F22-70 for collected scat sample within detection grid cell 22 -122.19015426 -122.19015426 44.26867920 44.26867920 787 787 meter WE035 unique location code F29-71 for collected scat sample within detection grid cell 29 -122.23042825 -122.23042825 44.22609390 44.22609390 567 567 meter WE035 unique location code F29-73 for collected scat sample within detection grid cell 29 -122.23042825 -122.23042825 44.22609390 44.22609390 567 567 meter WE035 unique location code F29-74 for collected scat sample within detection grid cell 29 -122.23042825 -122.23042825 44.22609390 44.22609390 567 567 meter WE035 unique location code F29-75 for collected scat sample within detection grid cell 29 -122.23042825 -122.23042825 44.22609390 44.22609390 567 567 meter WE035 unique location code F29-76 for collected scat sample within detection grid cell 29 -122.23042825 -122.23042825 44.22609390 44.22609390 567 567 meter WE035 unique location code F30-112 for collected scat sample within detection grid cell 30 -122.20769595 -122.20769595 44.22853139 44.22853139 644 644 meter WE035 unique location code F30-113 for collected scat sample within detection grid cell 30 -122.20769595 -122.20769595 44.22853139 44.22853139 644 644 meter WE035 unique location code F30-114 for collected scat sample within detection grid cell 30 -122.20769595 -122.20769595 44.22853139 44.22853139 644 644 meter WE035 unique location code F30-115 for collected scat sample within detection grid cell 30 -122.20769088 -122.20769088 44.22890949 44.22890949 629 629 meter WE035 unique location code F30-116 for collected scat sample within detection grid cell 30 -122.20769088 -122.20769088 44.22890949 44.22890949 629 629 meter WE035 unique location code F30-117 for collected scat sample within detection grid cell 30 -122.20769088 -122.20769088 44.22890949 44.22890949 629 629 meter WE035 unique location code F30-118 for collected scat sample within detection grid cell 30 -122.20776516 -122.20776516 44.22897302 44.22897302 627 627 meter WE035 unique location code F30-119 for collected scat sample within detection grid cell 30 -122.20776516 -122.20776516 44.22897302 44.22897302 627 627 meter WE035 unique location code F30-120 for collected scat sample within detection grid cell 30 -122.20776516 -122.20776516 44.22897302 44.22897302 627 627 meter WE035 unique location code F30-121 for collected scat sample within detection grid cell 30 -122.20767848 -122.20767848 44.22890040 44.22890040 629 629 meter WE035 unique location code F30-123 for collected scat sample within detection grid cell 30 -122.20756931 -122.20756931 44.22863855 44.22863855 638 638 meter WE035 unique location code F30-138 for collected scat sample within detection grid cell 30 -122.20770763 -122.20770763 44.22859449 44.22859449 640 640 meter WE035 unique location code F30-140 for collected scat sample within detection grid cell 30 -122.20724130 -122.20724130 44.22788901 44.22788901 692 692 meter WE035 unique location code F30-142 for collected scat sample within detection grid cell 30 -122.20959558 -122.20959558 44.22973296 44.22973296 619 619 meter WE035 unique location code F30-39 for collected scat sample within detection grid cell 30 -122.21079597 -122.21079597 44.23266728 44.23266728 547 547 meter WE035 unique location code F36-173 for collected scat sample within detection grid cell 36 -122.25597653 -122.25597653 44.20967037 44.20967037 438 438 meter WE035 unique location code F37-150 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-151 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-152 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-153 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-154 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-155 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-156 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-158 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-159 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-162 for collected scat sample within detection grid cell 37 -122.24035799 -122.24035799 44.21920094 44.21920094 547 547 meter WE035 unique location code F37-192 for collected scat sample within detection grid cell 37 -122.19493611 -122.19493611 44.21114715 44.21114715 1353 1353 meter WE035 unique location code F37-194 for collected scat sample within detection grid cell 37 -122.24582457 -122.24582457 44.21560890 44.21560890 474 474 meter WE035 unique location code F37-241 for collected scat sample within detection grid cell 37 -122.24038065 -122.24038065 44.21646414 44.21646414 603 603 meter WE035 unique location code F37-242 for collected scat sample within detection grid cell 37 -122.24038065 -122.24038065 44.21646414 44.21646414 603 603 meter WE035 unique location code F37-243 for collected scat sample within detection grid cell 37 -122.24038065 -122.24038065 44.21646414 44.21646414 603 603 meter WE035 unique location code F37-51 for collected scat sample within detection grid cell 37 -122.21642513 -122.21642513 44.20477829 44.20477829 894 894 meter WE035 unique location code F37-6 for collected scat sample within detection grid cell 37 -122.21949025 -122.21949025 44.20677097 44.20677097 863 863 meter WE035 unique location code F38-46 for collected scat sample within detection grid cell 38 -122.20748209 -122.20748209 44.21927469 44.21927469 908 908 meter WE035 unique location code F38-47 for collected scat sample within detection grid cell 38 -122.20748209 -122.20748209 44.21927469 44.21927469 908 908 meter WE035 unique location code MT284 for manually collected scat samples -122.24193911 -122.24193911 44.22281270 44.22281270 475 475 meter WE035 unique location code MT285 for manually collected scat samples -122.21309371 -122.21309371 44.22656101 44.22656101 647 647 meter WE035 unique location code MT287 for manually collected scat samples -122.22294543 -122.22294543 44.21338483 44.21338483 892 892 meter WE035 unique location code MT288 for manually collected scat samples -122.22804588 -122.22804588 44.21390558 44.21390558 846 846 meter WE035 unique location code MT289 for manually collected scat samples -122.22294543 -122.22294543 44.21338483 44.21338483 892 892 meter WE035 unique location code MT296 for manually collected scat samples -122.19388760 -122.19388760 44.27237886 44.27237886 616 616 meter WE035 unique location code MT315 for manually collected scat samples -122.25488921 -122.25488921 44.21251728 44.21251728 438 438 meter WE035 unique location code MT37 for manually collected scat samples -122.24229626 -122.24229626 44.22327423 44.22327423 482 482 meter WE035 unique location code MT383 for manually collected scat samples -122.25542787 -122.25542787 44.20950474 44.20950474 455 455 meter WE035 unique location code MT408 for manually collected scat samples -122.24345023 -122.24345023 44.22212948 44.22212948 470 470 meter WE035 unique location code MT431 for manually collected scat samples -122.19637883 -122.19637883 44.26703059 44.26703059 737 737 meter WE035 unique location code MT432 for manually collected scat samples -122.19637883 -122.19637883 44.26703059 44.26703059 737 737 meter WE035 unique location code MT433 for manually collected scat samples -122.19637883 -122.19637883 44.26703059 44.26703059 737 737 meter WE035 unique location code MT906 for manually collected scat samples -122.19384726 -122.19384726 44.27899581 44.27899581 709 709 meter WE035 unique location code MT907 for manually collected scat samples -122.24566942 -122.24566942 44.21599501 44.21599501 467 467 meter WE035 unique location code MT908 for manually collected scat samples -122.18626173 -122.18626173 44.25112255 44.25112255 747 747 meter WE035 unique location code MT909 for manually collected scat samples -122.24566942 -122.24566942 44.21599501 44.21599501 467 467 meter WE035 unique location code MT916 for manually collected scat samples -122.23519462 -122.23519462 44.20318589 44.20318589 832 832 meter WE035 unique location code MT918 for manually collected scat samples -122.12885316 -122.12885316 44.20803339 44.20803339 1499 1499 meter WE035 unique location code MT927 for manually collected scat samples -122.21989675 -122.21989675 44.21674923 44.21674923 797 797 meter WE035 unique location code S22-117 for collected scat sample within detection grid cell 22 -122.19641359 -122.19641359 44.26723790 44.26723790 723 723 meter WE035 unique location code S22-118 for collected scat sample within detection grid cell 22 -122.19637883 -122.19637883 44.26703059 44.26703059 737 737 meter WE035 unique location code S22-119 for collected scat sample within detection grid cell 22 -122.19637883 -122.19637883 44.26703059 44.26703059 737 737 meter WE035 unique location code S22-154 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-155 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-156 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-157 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-158 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-159 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-160 for collected scat sample within detection grid cell 22 -122.18937024 -122.18937024 44.27011413 44.27011413 739 739 meter WE035 unique location code S22-161 for collected scat sample within detection grid cell 22 -122.18891065 -122.18891065 44.26982277 44.26982277 750 750 meter WE035 unique location code S22-4 for collected scat sample within detection grid cell 22 -122.19391266 -122.19391266 44.27237903 44.27237903 616 616 meter WE035 unique location code S22-5 for collected scat sample within detection grid cell 22 -122.19150652 -122.19150652 44.26966111 44.26966111 726 726 meter WE035 unique location code S22-6 for collected scat sample within detection grid cell 22 -122.19019436 -122.19019436 44.26940873 44.26940873 777 777 meter WE035 unique location code S22-74 for collected scat sample within detection grid cell 22 -122.18235830 -122.18235830 44.25711774 44.25711774 820 820 meter WE035 unique location code S30-106 for collected scat sample within detection grid cell 30 -122.20936627 -122.20936627 44.22815583 44.22815583 637 637 meter WE035 unique location code S30-107 for collected scat sample within detection grid cell 30 -122.20936627 -122.20936627 44.22815583 44.22815583 637 637 meter WE035 unique location code S30-108 for collected scat sample within detection grid cell 30 -122.20925130 -122.20925130 44.22832609 44.22832609 636 636 meter WE035 unique location code S30-109 for collected scat sample within detection grid cell 30 -122.20925130 -122.20925130 44.22832609 44.22832609 636 636 meter WE035 unique location code S30-54 for collected scat sample within detection grid cell 30 -122.24562805 -122.24562805 44.21825452 44.21825452 458 458 meter WE035 unique location code S30-69 for collected scat sample within detection grid cell 30 -122.20935255 -122.20935255 44.22824577 44.22824577 636 636 meter WE035 unique location code S30-71 for collected scat sample within detection grid cell 30 -122.20935255 -122.20935255 44.22824577 44.22824577 636 636 meter WE035 unique location code S30-72 for collected scat sample within detection grid cell 30 -122.20957381 -122.20957381 44.22855340 44.22855340 627 627 meter WE035 unique location code S36-55 for collected scat sample within detection grid cell 36 -122.24582638 -122.24582638 44.21840889 44.21840889 469 469 meter WE035 unique location code S36-56 for collected scat sample within detection grid cell 36 -122.24577735 -122.24577735 44.21832753 44.21832753 462 462 meter WE035 unique location code S36-57 for collected scat sample within detection grid cell 36 -122.24562805 -122.24562805 44.21825452 44.21825452 458 458 meter WE035 unique location code S37-1 for collected scat sample within detection grid cell 37 -122.24400770 -122.24400770 44.21965730 44.21965730 477 477 meter WE035 unique location code S37-75 for collected scat sample within detection grid cell 37 -122.22652877 -122.22652877 44.22365472 44.22365472 607 607 meter WE035 unique location code S37-76 for collected scat sample within detection grid cell 37 -122.22704428 -122.22704428 44.22348715 44.22348715 601 601 meter WE035 unique location code S37-77 for collected scat sample within detection grid cell 37 -122.22704428 -122.22704428 44.22348715 44.22348715 601 601 meter WE035 unique location code S37-78 for collected scat sample within detection grid cell 37 -122.22704428 -122.22704428 44.22348715 44.22348715 601 601 meter WE035 unique location code S44-100 for collected scat sample within detection grid cell 44 -122.25262100 -122.25262100 44.18301707 44.18301707 615 615 meter WE035 unique location code S44-101 for collected scat sample within detection grid cell 44 -122.25262100 -122.25262100 44.18301707 44.18301707 615 615 meter WE035 unique location code S44-16 for collected scat sample within detection grid cell 44 -122.25598922 -122.25598922 44.18280497 44.18280497 695 695 meter WE035 unique location code S44-17 for collected scat sample within detection grid cell 44 -122.25598922 -122.25598922 44.18280497 44.18280497 695 695 meter WE035 unique location code S44-18 for collected scat sample within detection grid cell 44 -122.25598922 -122.25598922 44.18280497 44.18280497 695 695 meter WE035 unique location code S44-97 for collected scat sample within detection grid cell 44 -122.25262100 -122.25262100 44.18301707 44.18301707 615 615 meter WE035 unique location code S44-98 for collected scat sample within detection grid cell 44 -122.25262100 -122.25262100 44.18301707 44.18301707 615 615 meter WE035 unique location code S45-126 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-127 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-128 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-129 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-130 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-132 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-133 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-134 for collected scat sample within detection grid cell 45 -122.23260400 -122.23260400 44.19257179 44.19257179 627 627 meter WE035 unique location code S45-135 for collected scat sample within detection grid cell 45 -122.23250059 -122.23250059 44.18896982 44.18896982 583 583 meter WE035 scat detection grid cell number 15; see scat detection map -122.17255214 -122.13534138 44.30425907 44.27697438 895 895 meter WE035 scat detection grid cell number 22; see scat detection map -122.21052166 -122.17330983 44.27751874 44.25024628 869 869 meter WE035 scat detection grid cell number 29; see scat detection map -122.24845675 -122.21124391 44.25076542 44.22350519 567 567 meter WE035 scat detection grid cell number 30; see scat detection map -122.21088304 -122.17368788 44.25051203 44.22323969 692 692 meter WE035 scat detection grid cell number 36; see scat detection map -122.28635745 -122.21160428 44.22399914 44.19649822 469 469 meter WE035 scat detection grid cell number 37; see scat detection map -122.24880044 -122.21160428 44.22375834 44.19649822 1354 1354 meter WE035 scat detection grid cell number 38; see scat detection map -122.21124391 -122.17406540 44.22350519 44.19623297 909 909 meter WE035 scat detection grid cell number 44; see scat detection map -122.28668351 -122.21196414 44.19699171 44.16949112 695 695 meter WE035 scat detection grid cell number 45; see scat detection map -122.21160428 -122.17444240 44.19649822 44.16922612 628 628 meter WE035 manual, opportunistic scat collection within study area -122.28668351 -122.13534138 44.30425907 44.16922612 1500 1500 meter Posy Elizabeth Busby

Assistant Professor OSU Botany & Plant Pathology

busbyp@science.oregonstate.edu posybusby@gmail.com http://bpp.oregonstate.edu/content/posy-busby http://orcid.org/0000-0002-2837-9820 Principal Investigator Matthew G Betts

Department of Forest Ecosystems and Society; 201E Richardson Hall; College of Forestry; Oregon State University Corvallis OR 97331

(541) 737-3841 matt.betts@oregonstate.edu http://www.fsl.orst.edu/flel/index.htm http://orcid.org/0000-0002-7100-2551 Principal Investigator Brooke E. Penaluna brooke.penaluna@usda.gov Brooke.Penaluna@oregonstate.edu https://www.fs.fed.us/pnw/lwm/aem/people/penaluna.html http://orcid.org/0000-0001-7215-770X Principal Investigator Catalina Segura

Assistant Professor; Department of Forest Engineering, Resources, and Management; Oregon State University Corvallis OR 97331

541-737-6568 catalina.segura@oregonstate.edu http://ferm.forestry.oregonstate.edu/facstaff/segura-catalina http://orcid.org/0000-0002-0924-1172 Principal Investigator David Bell david.bell@usda.gov david.bell@oregonstate.edu https://lemma.forestry.oregonstate.edu/about/david-bell http://orcid.org/0000-0002-2673-5836 Principal Investigator The H.J. Andrews Experimental Forest is a living laboratory that provides unparalleled opportunities for the study of forest and stream ecosystems in the central Cascade Range of Oregon. Since 1980, as a part of the National Science Foundation Long Term Ecological Research (NSF-LTER) program, the Andrews Experimental Forest has become a leader in the analysis of forest and stream ecosystem dynamics. Long-term field experiments and measurement programs have focused on climate dynamics, streamflow, water quality, and vegetation succession. Currently researchers are working to develop concepts and tools needed to predict effects of natural disturbance, land use, and climate change on ecosystem structure, function, and species composition. The Andrews Experimental Forest is administered cooperatively by the USDA Forest Service Pacific Northwest Research Station, Oregon State University and the Willamette National Forest. Funding for the research program comes from the National Science Foundation (NSF), US Forest Service Pacific Northwest Research Station, Oregon State University, and other sources. Data were provided by the HJ Andrews Experimental Forest research program, funded by the National Science Foundation's Long-Term Ecological Research Program (DEB 2025755), US Forest Service Pacific Northwest Research Station, and Oregon State University. National Science Foundation: DEB2025755 National Science Foundation https://ror.org/021nxhr62 DEB2025755 https://www.nsf.gov/awardsearch/showAward?AWD_ID=2025755 The Andrews Forest is situated in the western Cascade Range of Oregon, and covers the entire 15,800-acre (6400-ha) drainage basin of Lookout Creek. Elevation ranges from 1350 to 5340 feet (410 to 1630 m). Broadly representative of the rugged mountainous landscape of the Pacific Northwest, the Andrews Forest contains excellent examples of the region's conifer forests and associated wildlife and stream ecosystems. These forests are among the tallest and most productive in the world, with tree heights of often greater than 250 ft (75 m). Streams are steep, cold and clean, providing habitat for numerous aquatic organisms. WE03501 Prey information for each scat within scat information; results from DNA metabarcoding and manual sorting WE03501_v1.csv 115184 e259ff6b81f8d207150d87c32f0afdc0 1 \r\n column , " https://andlter.forestry.oregonstate.edu/data/register/dataaccess.aspx?docid=WE03501_v1.csv 2017-08-03 2019-01-25 DBCODE FSDB Database Code char(5) WE035 FSDB Database Study Code WE035 ENTITY Entity number numeric(2,0) number 1 natural 1.0000 1.0000 SCAT_ID Unique sample code representing collection_type, grid_number, scat_number and its location char(7) F15-133 WE035 unique location code F15-133 for collected scat sample within detection grid cell 15 F15-134 WE035 unique location code F15-134 for collected scat sample within detection grid cell 15 F15-136 WE035 unique location code F15-136 for collected scat sample within detection grid cell 15 F15-137 WE035 unique location code F15-137 for collected scat sample within detection grid cell 15 F15-50 WE035 unique location code F15-50 for collected scat sample within detection grid cell 15 F22-101 WE035 unique location code F22-101 for collected scat sample within detection grid cell 22 F22-143 WE035 unique location code F22-143 for collected scat sample within detection grid cell 22 F22-18 WE035 unique location code F22-18 for collected scat sample within detection grid cell 22 F22-196 WE035 unique location code F22-196 for collected scat sample within detection grid cell 22 F22-197 WE035 unique location code F22-197 for collected scat sample within detection grid cell 22 F22-198 WE035 unique location code F22-198 for collected scat sample within detection grid cell 22 F22-199 WE035 unique location code F22-199 for collected scat sample within detection grid cell 22 F22-22 WE035 unique location code F22-22 for collected scat sample within detection grid cell 22 F22-224 WE035 unique location code F22-224 for collected scat sample within detection grid cell 22 F22-226 WE035 unique location code F22-226 for collected scat sample within detection grid cell 22 F22-300 WE035 unique location code F22-300 for collected scat sample within detection grid cell 22 F22-301 WE035 unique location code F22-301 for collected scat sample within detection grid cell 22 F22-302 WE035 unique location code F22-302 for collected scat sample within detection grid cell 22 F22-303 WE035 unique location code F22-303 for collected scat sample within detection grid cell 22 F22-307 WE035 unique location code F22-307 for collected scat sample within detection grid cell 22 F22-70 WE035 unique location code F22-70 for collected scat sample within detection grid cell 22 F29-71 WE035 unique location code F29-71 for collected scat sample within detection grid cell 29 F29-73 WE035 unique location code F29-73 for collected scat sample within detection grid cell 29 F29-74 WE035 unique location code F29-74 for collected scat sample within detection grid cell 29 F29-75 WE035 unique location code F29-75 for collected scat sample within detection grid cell 29 F29-76 WE035 unique location code F29-76 for collected scat sample within detection grid cell 29 F30-112 WE035 unique location code F30-112 for collected scat sample within detection grid cell 30 F30-113 WE035 unique location code F30-113 for collected scat sample within detection grid cell 30 F30-114 WE035 unique location code F30-114 for collected scat sample within detection grid cell 30 F30-115 WE035 unique location code F30-115 for collected scat sample within detection grid cell 30 F30-116 WE035 unique location code F30-116 for collected scat sample within detection grid cell 30 F30-117 WE035 unique location code F30-117 for collected scat sample within detection grid cell 30 F30-118 WE035 unique location code F30-118 for collected scat sample within detection grid cell 30 F30-119 WE035 unique location code F30-119 for collected scat sample within detection grid cell 30 F30-120 WE035 unique location code F30-120 for collected scat sample within detection grid cell 30 F30-121 WE035 unique location code F30-121 for collected scat sample within detection grid cell 30 F30-123 WE035 unique location code F30-123 for collected scat sample within detection grid cell 30 F30-138 WE035 unique location code F30-138 for collected scat sample within detection grid cell 30 F30-140 WE035 unique location code F30-140 for collected scat sample within detection grid cell 30 F30-142 WE035 unique location code F30-142 for collected scat sample within detection grid cell 30 F30-39 WE035 unique location code F30-39 for collected scat sample within detection grid cell 30 F36-173 WE035 unique location code F36-173 for collected scat sample within detection grid cell 36 F37-150 WE035 unique location code F37-150 for collected scat sample within detection grid cell 37 F37-151 WE035 unique location code F37-151 for collected scat sample within detection grid cell 37 F37-152 WE035 unique location code F37-152 for collected scat sample within detection grid cell 37 F37-153 WE035 unique location code F37-153 for collected scat sample within detection grid cell 37 F37-154 WE035 unique location code F37-154 for collected scat sample within detection grid cell 37 F37-155 WE035 unique location code F37-155 for collected scat sample within detection grid cell 37 F37-156 WE035 unique location code F37-156 for collected scat sample within detection grid cell 37 F37-158 WE035 unique location code F37-158 for collected scat sample within detection grid cell 37 F37-159 WE035 unique location code F37-159 for collected scat sample within detection grid cell 37 F37-162 WE035 unique location code F37-162 for collected scat sample within detection grid cell 37 F37-192 WE035 unique location code F37-192 for collected scat sample within detection grid cell 37 F37-194 WE035 unique location code F37-194 for collected scat sample within detection grid cell 37 F37-241 WE035 unique location code F37-241 for collected scat sample within detection grid cell 37 F37-242 WE035 unique location code F37-242 for collected scat sample within detection grid cell 37 F37-243 WE035 unique location code F37-243 for collected scat sample within detection grid cell 37 F37-51 WE035 unique location code F37-51 for collected scat sample within detection grid cell 37 F37-6 WE035 unique location code F37-6 for collected scat sample within detection grid cell 37 F38-46 WE035 unique location code F38-46 for collected scat sample within detection grid cell 38 F38-47 WE035 unique location code F38-47 for collected scat sample within detection grid cell 38 MT284 WE035 unique location code MT284 for manually collected scat samples MT285 WE035 unique location code MT285 for manually collected scat samples MT287 WE035 unique location code MT287 for manually collected scat samples MT288 WE035 unique location code MT288 for manually collected scat samples MT289 WE035 unique location code MT289 for manually collected scat samples MT296 WE035 unique location code MT296 for manually collected scat samples MT315 WE035 unique location code MT315 for manually collected scat samples MT37 WE035 unique location code MT37 for manually collected scat samples MT383 WE035 unique location code MT383 for manually collected scat samples MT408 WE035 unique location code MT408 for manually collected scat samples MT431 WE035 unique location code MT431 for manually collected scat samples MT432 WE035 unique location code MT432 for manually collected scat samples MT433 WE035 unique location code MT433 for manually collected scat samples MT906 WE035 unique location code MT906 for manually collected scat samples MT907 WE035 unique location code MT907 for manually collected scat samples MT908 WE035 unique location code MT908 for manually collected scat samples MT909 WE035 unique location code MT909 for manually collected scat samples MT916 WE035 unique location code MT916 for manually collected scat samples MT918 WE035 unique location code MT918 for manually collected scat samples MT927 WE035 unique location code MT927 for manually collected scat samples S22-117 WE035 unique location code S22-117 for collected scat sample within detection grid cell 22 S22-118 WE035 unique location code S22-118 for collected scat sample within detection grid cell 22 S22-119 WE035 unique location code S22-119 for collected scat sample within detection grid cell 22 S22-154 WE035 unique location code S22-154 for collected scat sample within detection grid cell 22 S22-155 WE035 unique location code S22-155 for collected scat sample within detection grid cell 22 S22-156 WE035 unique location code S22-156 for collected scat sample within detection grid cell 22 S22-157 WE035 unique location code S22-157 for collected scat sample within detection grid cell 22 S22-158 WE035 unique location code S22-158 for collected scat sample within detection grid cell 22 S22-159 WE035 unique location code S22-159 for collected scat sample within detection grid cell 22 S22-160 WE035 unique location code S22-160 for collected scat sample within detection grid cell 22 S22-161 WE035 unique location code S22-161 for collected scat sample within detection grid cell 22 S22-4 WE035 unique location code S22-4 for collected scat sample within detection grid cell 22 S22-5 WE035 unique location code S22-5 for collected scat sample within detection grid cell 22 S22-6 WE035 unique location code S22-6 for collected scat sample within detection grid cell 22 S22-74 WE035 unique location code S22-74 for collected scat sample within detection grid cell 22 S30-106 WE035 unique location code S30-106 for collected scat sample within detection grid cell 30 S30-107 WE035 unique location code S30-107 for collected scat sample within detection grid cell 30 S30-108 WE035 unique location code S30-108 for collected scat sample within detection grid cell 30 S30-109 WE035 unique location code S30-109 for collected scat sample within detection grid cell 30 S30-54 WE035 unique location code S30-54 for collected scat sample within detection grid cell 30 S30-69 WE035 unique location code S30-69 for collected scat sample within detection grid cell 30 S30-71 WE035 unique location code S30-71 for collected scat sample within detection grid cell 30 S30-72 WE035 unique location code S30-72 for collected scat sample within detection grid cell 30 S36-55 WE035 unique location code S36-55 for collected scat sample within detection grid cell 36 S36-56 WE035 unique location code S36-56 for collected scat sample within detection grid cell 36 S36-57 WE035 unique location code S36-57 for collected scat sample within detection grid cell 36 S37-1 WE035 unique location code S37-1 for collected scat sample within detection grid cell 37 S37-75 WE035 unique location code S37-75 for collected scat sample within detection grid cell 37 S37-76 WE035 unique location code S37-76 for collected scat sample within detection grid cell 37 S37-77 WE035 unique location code S37-77 for collected scat sample within detection grid cell 37 S37-78 WE035 unique location code S37-78 for collected scat sample within detection grid cell 37 S44-100 WE035 unique location code S44-100 for collected scat sample within detection grid cell 44 S44-101 WE035 unique location code S44-101 for collected scat sample within detection grid cell 44 S44-16 WE035 unique location code S44-16 for collected scat sample within detection grid cell 44 S44-17 WE035 unique location code S44-17 for collected scat sample within detection grid cell 44 S44-18 WE035 unique location code S44-18 for collected scat sample within detection grid cell 44 S44-97 WE035 unique location code S44-97 for collected scat sample within detection grid cell 44 S44-98 WE035 unique location code S44-98 for collected scat sample within detection grid cell 44 S45-126 WE035 unique location code S45-126 for collected scat sample within detection grid cell 45 S45-127 WE035 unique location code S45-127 for collected scat sample within detection grid cell 45 S45-128 WE035 unique location code S45-128 for collected scat sample within detection grid cell 45 S45-129 WE035 unique location code S45-129 for collected scat sample within detection grid cell 45 S45-130 WE035 unique location code S45-130 for collected scat sample within detection grid cell 45 S45-132 WE035 unique location code S45-132 for collected scat sample within detection grid cell 45 S45-133 WE035 unique location code S45-133 for collected scat sample within detection grid cell 45 S45-134 WE035 unique location code S45-134 for collected scat sample within detection grid cell 45 S45-135 WE035 unique location code S45-135 for collected scat sample within detection grid cell 45 GRID_NUMBER Sampling grid (3Km x 3Km) cell number char(2) 15 WE035 scat detection grid cell number 15; see scat detection map 22 WE035 scat detection grid cell number 22; see scat detection map 29 WE035 scat detection grid cell number 29; see scat detection map 30 WE035 scat detection grid cell number 30; see scat detection map 36 WE035 scat detection grid cell number 36; see scat detection map 37 WE035 scat detection grid cell number 37; see scat detection map 38 WE035 scat detection grid cell number 38; see scat detection map 44 WE035 scat detection grid cell number 44; see scat detection map 45 WE035 scat detection grid cell number 45; see scat detection map MT WE035 manual, opportunistic scat collection within study area SCAT_NUMBER Scat number within collection type numeric(3,0) number 1 natural 1.0000 927.0000 COLLECTION_TYPE Defines collection method and time frame char(2) S samples collected by Conservation K9s during summer 2018 (June-August) F samples collected by Conservation K9s during fall 2018 (October-November) MT samples collected opportunistically during field work from 2017-2019 COLLECTION_DATETIME Date and time scat was collected (time was not recorded for collection_tpe=MT); in Pacific Standard Time (PST) datetime YYYY-MM-DD hh:mm:ss 8/3/2017 12:00:00 AM 1/25/2019 12:00:00 AM LOCUS Region of genome used to barcode potential prey items: COI, 12s, manual, trnL char(6) COI COI locus of mitochondrial DNA that was used to barcode potential invertebrate prey items 12s 12s locus of mitochondrial DNA that was used to barcode potential vertebrate prey items manual scats that were manually sorted for coarse identification of prey items trnL trnL locus of chloroplast DNA that was used to barcode potential plant diet items PREY_SUPERKINGDOM Superkingdom of prey item detected within the scat char(15) Eukaryota All Organisms PREY_KINGDOM Kingdom of prey item detected within the scat varchar(20) Metazoa Animalia Viridiplantae Plantae Fungi Fungi PREY_PHYLUM Phylum of prey item detected within the scat varchar(20) Arthropoda Arthropoda Streptophyta Streptophyta Ascomycota Ascomycota Chordata Chordata Mollusca Mollusca Rotifera Rotifera PREY_SUBPHYLUM Subphylum of prey item detected within the scat varchar(20) Streptophytina Streptophytina Pezizomycotina Pezizomycotina Craniata Craniata Myriapoda Myriapoda Hexapoda Hexapoda Chelicerata Chelicerata PREY_CLASS Class of prey item detected within the scat varchar(30) Magnoliopsida Magnoliopsida Pinopsida Pinopsida Polypodiopsida Polypodiopsida Sordariomycetes Sordariomycetes Amphibia Amphibia Aves Aves Mammalia Mammalia Arachnida Arachnida Gastropoda Gastropoda Diplopoda Diplopoda Chilopoda Chilopoda Insecta Insecta Bdelloidea Bdelloidea Eurotatoria Eurotatoria Reptilia Reptilia PREY_ORDER Order of prey item detected within the scat varchar(30) Sapindales Sapindales Apiales Apiales Polypodiales Polypodiales Asterales Asterales Ranunculales Ranunculales Fagales Fagales Dipsacales Dipsacales Solanales Solanales Cornales Cornales Rosales Rosales Pinales Pinales Ericales Ericales Fabales Fabales Malvales Malvales Boraginales Boraginales Oxalidales Oxalidales Poales Poales Saxifragales Saxifragales Malpighiales Malpighiales Hypocreales Hypocreales Anura Anura Caudata Caudata Galliformes Galliformes Apodiformes Apodiformes Piciformes Piciformes Passeriformes Passeriformes Accipitriformes Accipitriformes Rodentia Rodentia Lagomorpha Lagomorpha Artiodactyla Artiodactyla Eulipotyphla Eulipotyphla Araneae Araneae Scolopendromorpha Scolopendromorpha Coleoptera Coleoptera Hemiptera Hemiptera Hymenoptera Hymenoptera Lepidoptera Lepidoptera Orthoptera Orthoptera Diptera Diptera Stylommatophora Stylommatophora Adinetida Adinetida Squamata Squamata PREY_FAMILY Family of prey item detected within the scat varchar(30) Araliaceae Araliaceae Asteraceae Asteraceae Berberidaceae Berberidaceae Betulaceae Betulaceae Blechnaceae Blechnaceae Caprifoliaceae Caprifoliaceae Convolvulaceae Convolvulaceae Cornaceae Cornaceae Dryopteridaceae Dryopteridaceae Ericaceae Ericaceae Fabaceae Fabaceae Fagaceae Fagaceae Hydrophyllaceae Hydrophyllaceae Malvaceae Malvaceae Oxalidaceae Oxalidaceae Pinaceae Pinaceae Poaceae Poaceae Ranunculaceae Ranunculaceae Rhamnaceae Rhamnaceae Rosaceae Rosaceae Salicaceae Salicaceae Saxifragaceae Saxifragaceae Solanaceae Solanaceae Sapindaceae Sapindaceae Adoxaceae Adoxaceae Athyriaceae Athyriaceae Nectriaceae Nectriaceae Plethodontidae Plethodontidae Hylidae Hylidae Ambystomatidae Ambystomatidae Rhyacotritonidae Rhyacotritonidae Salamandridae Salamandridae Cathartidae Cathartidae Phasianidae Phasianidae Trochilidae Trochilidae Picidae Picidae Turdidae Turdidae Motacillidae Motacillidae Bombycillidae Bombycillidae Thraupidae Thraupidae Passerellidae Passerellidae Sciuridae Sciuridae Bovidae Bovidae Cervidae Cervidae Soricidae Soricidae Cricetidae Cricetidae Leporidae Leporidae Talpidae Talpidae Araneidae Araneidae Theridiidae Theridiidae Cryptopidae Cryptopidae Rhaphidophoridae Rhaphidophoridae Cecidomyiidae Cecidomyiidae Chrysididae Chrysididae Cicadellidae Cicadellidae Ichneumonidae Ichneumonidae Lasiocampidae Lasiocampidae Psilidae Psilidae Staphylinidae Staphylinidae Vespidae Vespidae Arionidae Arionidae Haplotrematidae Haplotrematidae Polygyridae Polygyridae Adinetidae Adinetidae PREY_GENUS Genus of prey item detected within the scat varchar(30) Acer Acer Alnus Alnus Arachis Arachis Aralia Aralia Arctostaphylos Arctostaphylos Athyrium Athyrium Avena Avena Berberis Berberis Blechnum Blechnum Ceanothus Ceanothus Convolvulus Convolvulus Coptis Coptis Cornus Cornus Corylus Corylus Cytisus Cytisus Dryopteris Dryopteris Erigeron Erigeron Festuca Festuca Fragaria Fragaria Frangula Frangula Gaultheria Gaultheria Hydrophyllum Hydrophyllum Linnaea Linnaea Oemleria Oemleria Oxalis Oxalis Polystichum Polystichum Populus Populus Prunus Prunus Pseudotsuga Pseudotsuga Pyrola Pyrola Quercus Quercus Rhododendron Rhododendron Rubus Rubus Salix Salix Sambucus Sambucus Sorbus Sorbus Spiraea Spiraea Taraxacum Taraxacum Tolmiea Tolmiea Tsuga Tsuga Vaccinium Vaccinium Capsicum Capsicum Glycine Glycine Neonectria Neonectria Ambystoma Ambystoma Aneides Aneides Plethodon Plethodon Rhyacotriton Rhyacotriton Taricha Taricha Pseudacris Pseudacris Cathartes Cathartes Bonasa Bonasa Selasphorus Selasphorus Catharus Catharus Turdus Turdus Anthus Anthus Bombycilla Bombycilla Piranga Piranga Junco Junco Dryobates Dryobates Glaucomys Glaucomys Lepus Lepus Microtus Microtus Neurotrichus Neurotrichus Odocoileus Odocoileus Scapanus Scapanus Sorex Sorex Bos Bos Myodes Myodes Neotamias Neotamias Araneus Araneus Steatoda Steatoda Scolopocryptops Scolopocryptops Macropsis Macropsis Pristoceuthophilus Pristoceuthophilus Tolype Tolype Vespula Vespula Ceratochrysis Ceratochrysis Deinopteroloma Deinopteroloma Prophysaon Prophysaon Haplotrema Haplotrema Vespericola Vespericola Adineta Adineta PREY_SPECIES Species of prey item detected within the scat varchar(50) Alnus alnobetula Alnus alnobetula Alnus incana Alnus incana Arachis hypogaea Arachis hypogaea Aralia californica Aralia californica Athyrium brevifrons Athyrium brevifrons Avena nuda Avena nuda Berberis wallichiana Berberis wallichiana Ceanothus americanus Ceanothus americanus Ceanothus pumilus Ceanothus pumilus Coptis quinquesecta Coptis quinquesecta Cornus kousa Cornus kousa Cornus canadensis Cornus canadensis Corylus cornuta Corylus cornuta Cytisus striatus Cytisus striatus Erigeron cascadensis Erigeron cascadensis Festuca altissima Festuca altissima Fragaria vesca Fragaria vesca Frangula purshiana Frangula purshiana Hydrophyllum canadense Hydrophyllum canadense Linnaea borealis Linnaea borealis Oemleria cerasiformis Oemleria cerasiformis Oxalis tuberosa Oxalis tuberosa Polystichum vestitum Polystichum vestitum Polystichum weimingii Polystichum weimingii Populus mexicana Populus mexicana Populus suaveolens Populus suaveolens Prunus spinosa Prunus spinosa Pseudotsuga menziesii Pseudotsuga menziesii Pyrola aphylla Pyrola aphylla Quercus pubescens Quercus pubescens Rhododendron aureum Rhododendron aureum Rhododendron ungernii Rhododendron ungernii Rubus occidentalis Rubus occidentalis Rubus saxatilis Rubus saxatilis Salix zygostemon Salix zygostemon Sambucus williamsii Sambucus williamsii Spiraea pubescens Spiraea pubescens Taraxacum officinale Taraxacum officinale Tolmiea menziesii Tolmiea menziesii Tsuga heterophylla Tsuga heterophylla Capsicum pubescens Capsicum pubescens Neonectria ditissima Neonectria ditissima Aneides ferreus Aneides ferreus Plethodon dunni Plethodon dunni Taricha granulosa Taricha granulosa Rhyacotriton cascadae Rhyacotriton cascadae Pseudacris regilla Pseudacris regilla Cathartes aura Cathartes aura Bonasa umbellus Bonasa umbellus Selasphorus rufus Selasphorus rufus Catharus ustulatus Catharus ustulatus Turdus migratorius Turdus migratorius Anthus rubescens Anthus rubescens Bombycilla cedrorum Bombycilla cedrorum Piranga ludoviciana Piranga ludoviciana Junco hyemalis Junco hyemalis Dryobates pubescens Dryobates pubescens Lepus americanus Lepus americanus Microtus oregoni Microtus oregoni Neurotrichus gibbsii Neurotrichus gibbsii Odocoileus hemionus Odocoileus hemionus Scapanus orarius Scapanus orarius Sorex trowbridgii Sorex trowbridgii Bos taurus Bos taurus Neotamias townsendii Neotamias townsendii Glaucomys oregonensis Glaucomys oregonensis Araneus saevus Araneus saevus Steatoda bipunctata Steatoda bipunctata Scolopocryptops capillipedatus Scolopocryptops capillipedatus Pristoceuthophilus cercalis Pristoceuthophilus cercalis Tolype dayi Tolype dayi Vespula consobrina Vespula consobrina Deinopteroloma subcostatum Deinopteroloma subcostatum Prophysaon obscurum Prophysaon obscurum Adineta gracilis Adineta gracilis Adineta vaga Adineta vaga CARNIVORE assignment of scat defecator based on DNA metabarcoding varchar(50) Spilogale gracilis Spilogale gracilis SEQ DNA barcode sequence used to identify species. varchar(254) DNA barcode sequence used to identify species. NUMREPS Number of replicates that returned the same sequence (all samples run in triplicate) numeric(1,0) number 1 natural 2.0000 9.0000 NUMREADS Number of reads of unique sequences in each sample. Mean number of reads calculated for sequences that were in multiple replicates. numeric(8,1) number 1 real 7.0000 455460.3000 TOTALREADS Sum of all numreads for a sample numeric(8,1) number 1 real 34.7000 551050.0000 RRA Relative read abundance: calculated by dividing the numreads by totalreads per sample numeric(6,4) number 1 real 0.0088 1.0000 PIDMATCH Percent match of sequence with sequence in the GenBank database numeric(6,2) percent 1 real 82.3300 99.5400 QCOVER Query coverage: percentage of the query sequence (your specimen) that overlaps the reference sequence numeric(6,2) percent 1 real 18.0000 100.0000 BITSCORE Bit score: measures sequence similarity independent of query sequence length and database size and is normalized based on the rawpairwise alignment score numeric(6,2) number 1 real 56.2800 330.2500 PRIMARY WE03501.COLLECTION_DATETIME WE03501.COLLECTION_TYPE WE03501.SCAT_NUMBER WE03501.PREY_SUPERKINGDOM WE03501.GRID_NUMBER NOTNULL WE03501.CARNIVORE WE03501.COLLECTION_DATETIME WE03501.COLLECTION_TYPE WE03501.DBCODE WE03501.ENTITY WE03501.LOCUS WE03501.SCAT_ID WE03501.SCAT_NUMBER WE03501.PREY_SUPERKINGDOM WE03501.GRID_NUMBER 467 WE03502 Summarized information about prey composition for each scat scat-level information summarizing results from DNA metabarcoding and manual sorting by taxonomic class WE03502_v1.csv 9032 7c681cae62cb54b313c23acc52d77966 1 \r\n column , " https://andlter.forestry.oregonstate.edu/data/register/dataaccess.aspx?docid=WE03502_v1.csv 2017-08-03 2019-01-25 DBCODE FSDB Database Code char(5) WE035 FSDB Database Study Code WE035 ENTITY Entity number numeric(2,0) number 1 natural 2.0000 2.0000 SCAT_ID Unique sample code representing collection_type, grid_number, scat_number and its location char(7) F15-133 WE035 unique location code F15-133 for collected scat sample within detection grid cell 15 F15-134 WE035 unique location code F15-134 for collected scat sample within detection grid cell 15 F15-136 WE035 unique location code F15-136 for collected scat sample within detection grid cell 15 F15-137 WE035 unique location code F15-137 for collected scat sample within detection grid cell 15 F15-50 WE035 unique location code F15-50 for collected scat sample within detection grid cell 15 F22-101 WE035 unique location code F22-101 for collected scat sample within detection grid cell 22 F22-143 WE035 unique location code F22-143 for collected scat sample within detection grid cell 22 F22-18 WE035 unique location code F22-18 for collected scat sample within detection grid cell 22 F22-196 WE035 unique location code F22-196 for collected scat sample within detection grid cell 22 F22-197 WE035 unique location code F22-197 for collected scat sample within detection grid cell 22 F22-198 WE035 unique location code F22-198 for collected scat sample within detection grid cell 22 F22-199 WE035 unique location code F22-199 for collected scat sample within detection grid cell 22 F22-22 WE035 unique location code F22-22 for collected scat sample within detection grid cell 22 F22-224 WE035 unique location code F22-224 for collected scat sample within detection grid cell 22 F22-226 WE035 unique location code F22-226 for collected scat sample within detection grid cell 22 F22-300 WE035 unique location code F22-300 for collected scat sample within detection grid cell 22 F22-301 WE035 unique location code F22-301 for collected scat sample within detection grid cell 22 F22-302 WE035 unique location code F22-302 for collected scat sample within detection grid cell 22 F22-303 WE035 unique location code F22-303 for collected scat sample within detection grid cell 22 F22-307 WE035 unique location code F22-307 for collected scat sample within detection grid cell 22 F22-70 WE035 unique location code F22-70 for collected scat sample within detection grid cell 22 F29-71 WE035 unique location code F29-71 for collected scat sample within detection grid cell 29 F29-73 WE035 unique location code F29-73 for collected scat sample within detection grid cell 29 F29-74 WE035 unique location code F29-74 for collected scat sample within detection grid cell 29 F29-75 WE035 unique location code F29-75 for collected scat sample within detection grid cell 29 F29-76 WE035 unique location code F29-76 for collected scat sample within detection grid cell 29 F30-112 WE035 unique location code F30-112 for collected scat sample within detection grid cell 30 F30-113 WE035 unique location code F30-113 for collected scat sample within detection grid cell 30 F30-114 WE035 unique location code F30-114 for collected scat sample within detection grid cell 30 F30-115 WE035 unique location code F30-115 for collected scat sample within detection grid cell 30 F30-116 WE035 unique location code F30-116 for collected scat sample within detection grid cell 30 F30-117 WE035 unique location code F30-117 for collected scat sample within detection grid cell 30 F30-118 WE035 unique location code F30-118 for collected scat sample within detection grid cell 30 F30-119 WE035 unique location code F30-119 for collected scat sample within detection grid cell 30 F30-120 WE035 unique location code F30-120 for collected scat sample within detection grid cell 30 F30-121 WE035 unique location code F30-121 for collected scat sample within detection grid cell 30 F30-123 WE035 unique location code F30-123 for collected scat sample within detection grid cell 30 F30-138 WE035 unique location code F30-138 for collected scat sample within detection grid cell 30 F30-140 WE035 unique location code F30-140 for collected scat sample within detection grid cell 30 F30-142 WE035 unique location code F30-142 for collected scat sample within detection grid cell 30 F30-39 WE035 unique location code F30-39 for collected scat sample within detection grid cell 30 F36-173 WE035 unique location code F36-173 for collected scat sample within detection grid cell 36 F37-150 WE035 unique location code F37-150 for collected scat sample within detection grid cell 37 F37-151 WE035 unique location code F37-151 for collected scat sample within detection grid cell 37 F37-152 WE035 unique location code F37-152 for collected scat sample within detection grid cell 37 F37-153 WE035 unique location code F37-153 for collected scat sample within detection grid cell 37 F37-154 WE035 unique location code F37-154 for collected scat sample within detection grid cell 37 F37-155 WE035 unique location code F37-155 for collected scat sample within detection grid cell 37 F37-156 WE035 unique location code F37-156 for collected scat sample within detection grid cell 37 F37-158 WE035 unique location code F37-158 for collected scat sample within detection grid cell 37 F37-159 WE035 unique location code F37-159 for collected scat sample within detection grid cell 37 F37-162 WE035 unique location code F37-162 for collected scat sample within detection grid cell 37 F37-192 WE035 unique location code F37-192 for collected scat sample within detection grid cell 37 F37-194 WE035 unique location code F37-194 for collected scat sample within detection grid cell 37 F37-241 WE035 unique location code F37-241 for collected scat sample within detection grid cell 37 F37-242 WE035 unique location code F37-242 for collected scat sample within detection grid cell 37 F37-243 WE035 unique location code F37-243 for collected scat sample within detection grid cell 37 F37-51 WE035 unique location code F37-51 for collected scat sample within detection grid cell 37 F37-6 WE035 unique location code F37-6 for collected scat sample within detection grid cell 37 F38-46 WE035 unique location code F38-46 for collected scat sample within detection grid cell 38 F38-47 WE035 unique location code F38-47 for collected scat sample within detection grid cell 38 MT284 WE035 unique location code MT284 for manually collected scat samples MT285 WE035 unique location code MT285 for manually collected scat samples MT287 WE035 unique location code MT287 for manually collected scat samples MT288 WE035 unique location code MT288 for manually collected scat samples MT289 WE035 unique location code MT289 for manually collected scat samples MT296 WE035 unique location code MT296 for manually collected scat samples MT315 WE035 unique location code MT315 for manually collected scat samples MT37 WE035 unique location code MT37 for manually collected scat samples MT383 WE035 unique location code MT383 for manually collected scat samples MT408 WE035 unique location code MT408 for manually collected scat samples MT431 WE035 unique location code MT431 for manually collected scat samples MT432 WE035 unique location code MT432 for manually collected scat samples MT433 WE035 unique location code MT433 for manually collected scat samples MT906 WE035 unique location code MT906 for manually collected scat samples MT907 WE035 unique location code MT907 for manually collected scat samples MT908 WE035 unique location code MT908 for manually collected scat samples MT909 WE035 unique location code MT909 for manually collected scat samples MT916 WE035 unique location code MT916 for manually collected scat samples MT918 WE035 unique location code MT918 for manually collected scat samples MT927 WE035 unique location code MT927 for manually collected scat samples S22-117 WE035 unique location code S22-117 for collected scat sample within detection grid cell 22 S22-118 WE035 unique location code S22-118 for collected scat sample within detection grid cell 22 S22-119 WE035 unique location code S22-119 for collected scat sample within detection grid cell 22 S22-154 WE035 unique location code S22-154 for collected scat sample within detection grid cell 22 S22-155 WE035 unique location code S22-155 for collected scat sample within detection grid cell 22 S22-156 WE035 unique location code S22-156 for collected scat sample within detection grid cell 22 S22-157 WE035 unique location code S22-157 for collected scat sample within detection grid cell 22 S22-158 WE035 unique location code S22-158 for collected scat sample within detection grid cell 22 S22-159 WE035 unique location code S22-159 for collected scat sample within detection grid cell 22 S22-160 WE035 unique location code S22-160 for collected scat sample within detection grid cell 22 S22-161 WE035 unique location code S22-161 for collected scat sample within detection grid cell 22 S22-4 WE035 unique location code S22-4 for collected scat sample within detection grid cell 22 S22-5 WE035 unique location code S22-5 for collected scat sample within detection grid cell 22 S22-6 WE035 unique location code S22-6 for collected scat sample within detection grid cell 22 S22-74 WE035 unique location code S22-74 for collected scat sample within detection grid cell 22 S30-106 WE035 unique location code S30-106 for collected scat sample within detection grid cell 30 S30-107 WE035 unique location code S30-107 for collected scat sample within detection grid cell 30 S30-108 WE035 unique location code S30-108 for collected scat sample within detection grid cell 30 S30-109 WE035 unique location code S30-109 for collected scat sample within detection grid cell 30 S30-54 WE035 unique location code S30-54 for collected scat sample within detection grid cell 30 S30-69 WE035 unique location code S30-69 for collected scat sample within detection grid cell 30 S30-71 WE035 unique location code S30-71 for collected scat sample within detection grid cell 30 S30-72 WE035 unique location code S30-72 for collected scat sample within detection grid cell 30 S36-55 WE035 unique location code S36-55 for collected scat sample within detection grid cell 36 S36-56 WE035 unique location code S36-56 for collected scat sample within detection grid cell 36 S36-57 WE035 unique location code S36-57 for collected scat sample within detection grid cell 36 S37-1 WE035 unique location code S37-1 for collected scat sample within detection grid cell 37 S37-75 WE035 unique location code S37-75 for collected scat sample within detection grid cell 37 S37-76 WE035 unique location code S37-76 for collected scat sample within detection grid cell 37 S37-77 WE035 unique location code S37-77 for collected scat sample within detection grid cell 37 S37-78 WE035 unique location code S37-78 for collected scat sample within detection grid cell 37 S44-100 WE035 unique location code S44-100 for collected scat sample within detection grid cell 44 S44-101 WE035 unique location code S44-101 for collected scat sample within detection grid cell 44 S44-16 WE035 unique location code S44-16 for collected scat sample within detection grid cell 44 S44-17 WE035 unique location code S44-17 for collected scat sample within detection grid cell 44 S44-18 WE035 unique location code S44-18 for collected scat sample within detection grid cell 44 S44-97 WE035 unique location code S44-97 for collected scat sample within detection grid cell 44 S44-98 WE035 unique location code S44-98 for collected scat sample within detection grid cell 44 S45-126 WE035 unique location code S45-126 for collected scat sample within detection grid cell 45 S45-127 WE035 unique location code S45-127 for collected scat sample within detection grid cell 45 S45-128 WE035 unique location code S45-128 for collected scat sample within detection grid cell 45 S45-129 WE035 unique location code S45-129 for collected scat sample within detection grid cell 45 S45-130 WE035 unique location code S45-130 for collected scat sample within detection grid cell 45 S45-132 WE035 unique location code S45-132 for collected scat sample within detection grid cell 45 S45-133 WE035 unique location code S45-133 for collected scat sample within detection grid cell 45 S45-134 WE035 unique location code S45-134 for collected scat sample within detection grid cell 45 S45-135 WE035 unique location code S45-135 for collected scat sample within detection grid cell 45 GRID_NUMBER Sampling grid (3Km x 3Km) cell number char(2) 15 WE035 scat detection grid cell number 15; see scat detection map 22 WE035 scat detection grid cell number 22; see scat detection map 29 WE035 scat detection grid cell number 29; see scat detection map 30 WE035 scat detection grid cell number 30; see scat detection map 36 WE035 scat detection grid cell number 36; see scat detection map 37 WE035 scat detection grid cell number 37; see scat detection map 38 WE035 scat detection grid cell number 38; see scat detection map 44 WE035 scat detection grid cell number 44; see scat detection map 45 WE035 scat detection grid cell number 45; see scat detection map MT WE035 manual, opportunistic scat collection within study area SCAT_NUMBER Scat number within collection type numeric(3,0) number 1 natural 1.0000 927.0000 COLLECTION_TYPE Defines collection method and time frame char(2) S samples collected by Conservation K9s during summer 2018 (June-August) F samples collected by Conservation K9s during fall 2018 (October-November) MT samples collected opportunistically during field work from 2017-2019 COLLECTION_DATETIME Date and time scat was collected (time was not recorded for collection_tpe=MT); in Pacific Standard Time (PST) datetime YYYY-MM-DD hh:mm:ss 8/3/2017 12:00:00 AM 1/25/2019 12:00:00 AM SEASON Season when sample collected char(3) wet scat samples collected during the wet season (September - May) dry scat samples collected during the dry season (June - August) AMPHIBIA indicates whether or not the taxonomic class Amphibia was detected in scat sample char(1) 0 taxonomic class Amphibia were not detected in scat sample 1 taxonomic class Amphibia were detected in scat sample AVES indicates whether or not the taxonomic class Aves was detected in scat sample char(1) 0 taxonomic class Aves were not detected in scat sample 1 taxonomic class Aves were detected in scat sample MAMMALIA indicates whether or not the taxonomic class Mammalia was detected in scat sample char(1) 0 taxonomic class Mammalia were not detected in scat sample 1 taxonomic class Mammalia were detected in scat sample REPTILIA indicates whether or not the taxonomic class Reptilia was detected in scat sample char(1) 0 taxonomic class Reptilia were not detected in scat sample 1 taxonomic class Reptilia were detected in scat sample GASTROPODA indicates whether or not the taxonomic class Gastropoda was detected in scat sample char(1) 0 taxonomic class Gastropoda were not detected in scat sample 1 taxonomic class Gastropoda were detected in scat sample ARACHNIDA indicates whether or not the taxonomic class Arachnida was detected in scat sample char(1) 0 taxonomic class Arachnida were not detected in scat sample 1 taxonomic class Arachnida were detected in scat sample MYRIAPODA indicates whether or not the taxonomic class Myriapoda was detected in scat sample char(1) 0 taxonomic class Myriapoda were not detected in scat sample 1 taxonomic class Myriapoda were detected in scat sample INSECTA indicates whether or not the taxonomic class Insecta was detected in scat sample char(1) 0 taxonomic class Insecta were not detected in scat sample 1 taxonomic class Insecta were detected in scat sample STREPTOPHYTA indicates whether or not the taxonomic class Streptophyta was detected in scat sample char(1) 0 taxonomic class Streptophyta were not detected in scat sample 1 taxonomic class Streptophyta were detected in scat sample PRIMARY WE03502.COLLECTION_DATETIME WE03502.COLLECTION_TYPE WE03502.SCAT_NUMBER WE03502.GRID_NUMBER NOTNULL WE03502.AMPHIBIA WE03502.ARACHNIDA WE03502.AVES WE03502.COLLECTION_DATETIME WE03502.COLLECTION_TYPE WE03502.DBCODE WE03502.ENTITY WE03502.GASTROPODA WE03502.INSECTA WE03502.MAMMALIA WE03502.MYRIAPODA WE03502.REPTILIA WE03502.SCAT_ID WE03502.SCAT_NUMBER WE03502.SEASON WE03502.STREPTOPHYTA WE03502.GRID_NUMBER 128 WE03503 Location information for each scat associated environmental attributes of the location where the scat was collected WE03503_v1.csv 17385 9360a7965625d60e0adad62cf43c6ccf 1 \r\n column , " https://andlter.forestry.oregonstate.edu/data/register/dataaccess.aspx?docid=WE03503_v1.csv 2017-08-03 2019-01-25 DBCODE FSDB Database Code char(5) WE035 FSDB Database Study Code WE035 ENTITY Entity number numeric(2,0) number 1 natural 3.0000 3.0000 SCAT_ID Unique sample code representing collection_type, grid_number, scat_number and its location char(7) F15-133 WE035 unique location code F15-133 for collected scat sample within detection grid cell 15 F15-134 WE035 unique location code F15-134 for collected scat sample within detection grid cell 15 F15-136 WE035 unique location code F15-136 for collected scat sample within detection grid cell 15 F15-137 WE035 unique location code F15-137 for collected scat sample within detection grid cell 15 F15-50 WE035 unique location code F15-50 for collected scat sample within detection grid cell 15 F22-101 WE035 unique location code F22-101 for collected scat sample within detection grid cell 22 F22-143 WE035 unique location code F22-143 for collected scat sample within detection grid cell 22 F22-18 WE035 unique location code F22-18 for collected scat sample within detection grid cell 22 F22-196 WE035 unique location code F22-196 for collected scat sample within detection grid cell 22 F22-197 WE035 unique location code F22-197 for collected scat sample within detection grid cell 22 F22-198 WE035 unique location code F22-198 for collected scat sample within detection grid cell 22 F22-199 WE035 unique location code F22-199 for collected scat sample within detection grid cell 22 F22-22 WE035 unique location code F22-22 for collected scat sample within detection grid cell 22 F22-224 WE035 unique location code F22-224 for collected scat sample within detection grid cell 22 F22-226 WE035 unique location code F22-226 for collected scat sample within detection grid cell 22 F22-300 WE035 unique location code F22-300 for collected scat sample within detection grid cell 22 F22-301 WE035 unique location code F22-301 for collected scat sample within detection grid cell 22 F22-302 WE035 unique location code F22-302 for collected scat sample within detection grid cell 22 F22-303 WE035 unique location code F22-303 for collected scat sample within detection grid cell 22 F22-307 WE035 unique location code F22-307 for collected scat sample within detection grid cell 22 F22-70 WE035 unique location code F22-70 for collected scat sample within detection grid cell 22 F29-71 WE035 unique location code F29-71 for collected scat sample within detection grid cell 29 F29-73 WE035 unique location code F29-73 for collected scat sample within detection grid cell 29 F29-74 WE035 unique location code F29-74 for collected scat sample within detection grid cell 29 F29-75 WE035 unique location code F29-75 for collected scat sample within detection grid cell 29 F29-76 WE035 unique location code F29-76 for collected scat sample within detection grid cell 29 F30-112 WE035 unique location code F30-112 for collected scat sample within detection grid cell 30 F30-113 WE035 unique location code F30-113 for collected scat sample within detection grid cell 30 F30-114 WE035 unique location code F30-114 for collected scat sample within detection grid cell 30 F30-115 WE035 unique location code F30-115 for collected scat sample within detection grid cell 30 F30-116 WE035 unique location code F30-116 for collected scat sample within detection grid cell 30 F30-117 WE035 unique location code F30-117 for collected scat sample within detection grid cell 30 F30-118 WE035 unique location code F30-118 for collected scat sample within detection grid cell 30 F30-119 WE035 unique location code F30-119 for collected scat sample within detection grid cell 30 F30-120 WE035 unique location code F30-120 for collected scat sample within detection grid cell 30 F30-121 WE035 unique location code F30-121 for collected scat sample within detection grid cell 30 F30-123 WE035 unique location code F30-123 for collected scat sample within detection grid cell 30 F30-138 WE035 unique location code F30-138 for collected scat sample within detection grid cell 30 F30-140 WE035 unique location code F30-140 for collected scat sample within detection grid cell 30 F30-142 WE035 unique location code F30-142 for collected scat sample within detection grid cell 30 F30-39 WE035 unique location code F30-39 for collected scat sample within detection grid cell 30 F36-173 WE035 unique location code F36-173 for collected scat sample within detection grid cell 36 F37-150 WE035 unique location code F37-150 for collected scat sample within detection grid cell 37 F37-151 WE035 unique location code F37-151 for collected scat sample within detection grid cell 37 F37-152 WE035 unique location code F37-152 for collected scat sample within detection grid cell 37 F37-153 WE035 unique location code F37-153 for collected scat sample within detection grid cell 37 F37-154 WE035 unique location code F37-154 for collected scat sample within detection grid cell 37 F37-155 WE035 unique location code F37-155 for collected scat sample within detection grid cell 37 F37-156 WE035 unique location code F37-156 for collected scat sample within detection grid cell 37 F37-158 WE035 unique location code F37-158 for collected scat sample within detection grid cell 37 F37-159 WE035 unique location code F37-159 for collected scat sample within detection grid cell 37 F37-162 WE035 unique location code F37-162 for collected scat sample within detection grid cell 37 F37-192 WE035 unique location code F37-192 for collected scat sample within detection grid cell 37 F37-194 WE035 unique location code F37-194 for collected scat sample within detection grid cell 37 F37-241 WE035 unique location code F37-241 for collected scat sample within detection grid cell 37 F37-242 WE035 unique location code F37-242 for collected scat sample within detection grid cell 37 F37-243 WE035 unique location code F37-243 for collected scat sample within detection grid cell 37 F37-51 WE035 unique location code F37-51 for collected scat sample within detection grid cell 37 F37-6 WE035 unique location code F37-6 for collected scat sample within detection grid cell 37 F38-46 WE035 unique location code F38-46 for collected scat sample within detection grid cell 38 F38-47 WE035 unique location code F38-47 for collected scat sample within detection grid cell 38 MT284 WE035 unique location code MT284 for manually collected scat samples MT285 WE035 unique location code MT285 for manually collected scat samples MT287 WE035 unique location code MT287 for manually collected scat samples MT288 WE035 unique location code MT288 for manually collected scat samples MT289 WE035 unique location code MT289 for manually collected scat samples MT296 WE035 unique location code MT296 for manually collected scat samples MT315 WE035 unique location code MT315 for manually collected scat samples MT37 WE035 unique location code MT37 for manually collected scat samples MT383 WE035 unique location code MT383 for manually collected scat samples MT408 WE035 unique location code MT408 for manually collected scat samples MT431 WE035 unique location code MT431 for manually collected scat samples MT432 WE035 unique location code MT432 for manually collected scat samples MT433 WE035 unique location code MT433 for manually collected scat samples MT906 WE035 unique location code MT906 for manually collected scat samples MT907 WE035 unique location code MT907 for manually collected scat samples MT908 WE035 unique location code MT908 for manually collected scat samples MT909 WE035 unique location code MT909 for manually collected scat samples MT916 WE035 unique location code MT916 for manually collected scat samples MT918 WE035 unique location code MT918 for manually collected scat samples MT927 WE035 unique location code MT927 for manually collected scat samples S22-117 WE035 unique location code S22-117 for collected scat sample within detection grid cell 22 S22-118 WE035 unique location code S22-118 for collected scat sample within detection grid cell 22 S22-119 WE035 unique location code S22-119 for collected scat sample within detection grid cell 22 S22-154 WE035 unique location code S22-154 for collected scat sample within detection grid cell 22 S22-155 WE035 unique location code S22-155 for collected scat sample within detection grid cell 22 S22-156 WE035 unique location code S22-156 for collected scat sample within detection grid cell 22 S22-157 WE035 unique location code S22-157 for collected scat sample within detection grid cell 22 S22-158 WE035 unique location code S22-158 for collected scat sample within detection grid cell 22 S22-159 WE035 unique location code S22-159 for collected scat sample within detection grid cell 22 S22-160 WE035 unique location code S22-160 for collected scat sample within detection grid cell 22 S22-161 WE035 unique location code S22-161 for collected scat sample within detection grid cell 22 S22-4 WE035 unique location code S22-4 for collected scat sample within detection grid cell 22 S22-5 WE035 unique location code S22-5 for collected scat sample within detection grid cell 22 S22-6 WE035 unique location code S22-6 for collected scat sample within detection grid cell 22 S22-74 WE035 unique location code S22-74 for collected scat sample within detection grid cell 22 S30-106 WE035 unique location code S30-106 for collected scat sample within detection grid cell 30 S30-107 WE035 unique location code S30-107 for collected scat sample within detection grid cell 30 S30-108 WE035 unique location code S30-108 for collected scat sample within detection grid cell 30 S30-109 WE035 unique location code S30-109 for collected scat sample within detection grid cell 30 S30-54 WE035 unique location code S30-54 for collected scat sample within detection grid cell 30 S30-69 WE035 unique location code S30-69 for collected scat sample within detection grid cell 30 S30-71 WE035 unique location code S30-71 for collected scat sample within detection grid cell 30 S30-72 WE035 unique location code S30-72 for collected scat sample within detection grid cell 30 S36-55 WE035 unique location code S36-55 for collected scat sample within detection grid cell 36 S36-56 WE035 unique location code S36-56 for collected scat sample within detection grid cell 36 S36-57 WE035 unique location code S36-57 for collected scat sample within detection grid cell 36 S37-1 WE035 unique location code S37-1 for collected scat sample within detection grid cell 37 S37-75 WE035 unique location code S37-75 for collected scat sample within detection grid cell 37 S37-76 WE035 unique location code S37-76 for collected scat sample within detection grid cell 37 S37-77 WE035 unique location code S37-77 for collected scat sample within detection grid cell 37 S37-78 WE035 unique location code S37-78 for collected scat sample within detection grid cell 37 S44-100 WE035 unique location code S44-100 for collected scat sample within detection grid cell 44 S44-101 WE035 unique location code S44-101 for collected scat sample within detection grid cell 44 S44-16 WE035 unique location code S44-16 for collected scat sample within detection grid cell 44 S44-17 WE035 unique location code S44-17 for collected scat sample within detection grid cell 44 S44-18 WE035 unique location code S44-18 for collected scat sample within detection grid cell 44 S44-97 WE035 unique location code S44-97 for collected scat sample within detection grid cell 44 S44-98 WE035 unique location code S44-98 for collected scat sample within detection grid cell 44 S45-126 WE035 unique location code S45-126 for collected scat sample within detection grid cell 45 S45-127 WE035 unique location code S45-127 for collected scat sample within detection grid cell 45 S45-128 WE035 unique location code S45-128 for collected scat sample within detection grid cell 45 S45-129 WE035 unique location code S45-129 for collected scat sample within detection grid cell 45 S45-130 WE035 unique location code S45-130 for collected scat sample within detection grid cell 45 S45-132 WE035 unique location code S45-132 for collected scat sample within detection grid cell 45 S45-133 WE035 unique location code S45-133 for collected scat sample within detection grid cell 45 S45-134 WE035 unique location code S45-134 for collected scat sample within detection grid cell 45 S45-135 WE035 unique location code S45-135 for collected scat sample within detection grid cell 45 GRID_NUMBER Sampling grid (3Km x 3Km) cell number char(2) 15 WE035 scat detection grid cell number 15; see scat detection map 22 WE035 scat detection grid cell number 22; see scat detection map 29 WE035 scat detection grid cell number 29; see scat detection map 30 WE035 scat detection grid cell number 30; see scat detection map 36 WE035 scat detection grid cell number 36; see scat detection map 37 WE035 scat detection grid cell number 37; see scat detection map 38 WE035 scat detection grid cell number 38; see scat detection map 44 WE035 scat detection grid cell number 44; see scat detection map 45 WE035 scat detection grid cell number 45; see scat detection map MT WE035 manual, opportunistic scat collection within study area SCAT_NUMBER Scat number within collection type numeric(3,0) number 1 natural 1.0000 927.0000 COLLECTION_TYPE Defines collection method and time frame char(2) S samples collected by Conservation K9s during summer 2018 (June-August) F samples collected by Conservation K9s during fall 2018 (October-November) MT samples collected opportunistically during field work from 2017-2019 COLLECTION_DATETIME Date and time scat was collected (time was not recorded for collection_tpe=MT); in Pacific Standard Time (PST) datetime YYYY-MM-DD hh:mm:ss 8/3/2017 12:00:00 AM 1/25/2019 12:00:00 AM EASTING Easting in NAD 83 UTM Zone 10 numeric(6,0) meters 1 natural 559441.0000 569599.0000 NORTHING Northing in NAD 83 UTM Zone 10 numeric(7,0) meters 1 natural 4892446.0000 4904080.0000 ELEVATION elevation of collection site above sea level; derived from DEM using LiDAR, converted from feet numeric(6,1) meters 1 real 438.4000 1499.9000 YR_LOGGED year stand was logged (if logged) from historical records numeric(4,0) year (yyyy) 1 whole 1946.0000 1990.0000 YRSSINCEDI years since stand disturbance via logging; stands with no logging record were assigned 200 years. numeric(3,0) number 1 natural 28.0000 200.0000 TREATMENT type of logging that occurred on stand from historical records char(2) CT Commercial Thinning CC Clearcut NA No known logging occurred within the last 100 years CLASS time since logging classified into 3 groups char(1) 1 stand logged 0-40 years ago 2 stand logged 41-80 years ago> 100 years 3 stand logged > 100 years ago HJA indicates whether the site is within or outside of the HJ Andrews Experimental Forest boundary char(1) 0 site is outside of the HJ Andrews Experimental Forest boundary 1 site is within the HJ Andrews Experimental Forest boundary LOGGED indicates whether the location of scat collected was within or outside of a logged area char(1) 0 location of scat collected was not within a logged area 1 location of scat collected was within a logged area VALUE_R100 area within 100 m of the scat location that was logged numeric(4,2) hectares 1 real 0.2700 3.3300 PERCENTAGE_INSIDE_R100 percent area within 100 m of the scat location that was logged numeric(6,2) percent 1 real 8.6000 106.0700 VALUE_R500 area within 500 m of the scat location that was logged numeric(5,2) hectares 1 real 7.9200 70.7400 PERCENTAGE_INSIDE_R500 percent area within 500 m of the scat location that was logged numeric(6,2) percent 1 real 10.0900 90.1300 VALUE_R1000 area within 1 km of the scat location that was logged numeric(6,2) hectares 1 real 26.5500 253.8900 PERCENTAGE_INSIDE_R1000 perent area within 1 km of the scat location that was logged numeric(6,2) percent 1 real 8.4600 80.8700 VALUE_R5000 area within 5 km of the scat location that was logged numeric(7,2) hectares 1 real 1191.2400 2945.8800 PERCENTAGE_INSIDE_R5000 percent area within 5 km of the scat location that was logged numeric(6,2) percent 1 real 15.1800 37.5300 PRIMARY WE03503.COLLECTION_DATETIME WE03503.COLLECTION_TYPE WE03503.SCAT_NUMBER WE03503.GRID_NUMBER NOTNULL WE03503.CLASS WE03503.COLLECTION_DATETIME WE03503.COLLECTION_TYPE WE03503.DBCODE WE03503.EASTING WE03503.ELEVATION WE03503.ENTITY WE03503.HJA WE03503.LOGGED WE03503.NORTHING WE03503.PERCENTAGE_INSIDE_R100 WE03503.PERCENTAGE_INSIDE_R1000 WE03503.PERCENTAGE_INSIDE_R500 WE03503.PERCENTAGE_INSIDE_R5000 WE03503.SCAT_ID WE03503.SCAT_NUMBER WE03503.TREATMENT WE03503.YRSSINCEDI WE03503.GRID_NUMBER 128 meter; SI unit of length percent; a number hectares; 1 hectare is 10^4 square meters dimensionless number, i.e., ratio, count year (4 character) portion of date